درمان برونشيت در طيور گوشتي

درمان برونشيت در طيور گوشتي

پیشنهاد شما مخصوص شما :

خواص دارویی و گیاهی

درمان برونشيت در طيور گوشتي

درمان برونشيت در طيور گوشتي

نقل و نشر مطالب با ذکر نام موسسه اطلاعات مرغداری آزاد است.

توليد شده توسط نرم افزار جامع ”استوديو خبر“

مقدمه

 

     بیماری برونشیت عفونی ماکیان یک بیماری ویروسی تنفسی است که از تمام کشورها گزارش شده است. این بیماری از لحاظ اقتصادی به دلیل هزینه­های مرتبط با رخداد تلفات، دارو درمانی و حذف لاشه در کشتارگاه واجد اهمیت است. ویروس عامل بیماری از خانوادة کروناویریده و متعلق به گروه 3 کروناویروس­ها می­باشد. این ویروس دارای 3 پروتئین اصلی شامل گلیکوپروتئین­های خاری (S)، غشایی (M) و پروتئین داخلی نوکلئوکپسید می­باشد. پروتئین Sدارای دو تحت واحدS1  وS2  است. گلیکوپپتیدهای S1مسئول القای آنتی بادی­های ممانعت کننده از هماگلوتیناسیون و آنتی بادی­های خنثی کننده ویروس و تنوع سروتیپی می­باشند و تنها تغییر چند اسید آمینه در قسمت  S1  ویروس می­تواند منجر به ایجاد یک سروتیپ جدید شود (8).  از آنجایی که ویروس عامل برونشیت عفونی شدیداً مستعد تغییرات آنتی ژنی و ژنتیکی می­باشد و از طرفی ایمنی علیه هر سروتیپ کاملاً اختصاصی است و درجة حفاظت متقابل بین سویه­ها با افزایش تفاوت توالی S1 کاهش پیدا می­کند (8 و2) بنابراین شناسایی و بررسی دوره­ای سروتیپ­های موجود در منطقه در جهت استفاده از واکسن­های حاوی سروتیپ­های موجود در منطقه یک گام مهم در راستای پیشگیری از این بیماری می­باشد.

هدف از این بررسی، شناسایی مولکولی ویروس­های برونشیت عفونی در استان چهارمحال و بختیاری است تا با تعیین تیپ جدایه­های ویروس برونشیت عفونی یک راهبرد مناسب واکسیناسیون هم تراز با سروتیپ­های موجود در استان اتخاذ شود.

مواد و روش­ها

درمان برونشيت در طيور گوشتي

نمونه گیری

در این بررسی از 18 گله جوجه گوشتی مبتلا به سندرم تنفسی از نقاط مختلف استان چهارمحال و بختیاری، با اخذ تاریخچه، نمونه بافتی نای تهیه شد. گله­های واجد سندرم تنفسی دارای علایمی همچون عطسه، سرفه، رالهای تنفسی و آبریزش از چشم و بینی به همراه انسداد مجاری تنفسی و تورم سینوس­ها بودند. تمام گله­های نمونه­گیری شده واجد تلفات بالای یک درصد در روز و فاقد برنامه واکسیناسیون علیه سویه 91/4 برونشیت عفونی بودند. 

شناسایی ویروس 91/4 برونشیت عفونی در گله­های واجد علایم تنفسی بر اساس آزمون PCR بر روی نمونه­های بافتی نای انجام شد.RNA  ویروسی از نمونه نای با کیت تخلیص RNA(High Pure Viral Nucleic Acid Kit، ساخت شرکت Roche) استخراج شد.

واکنش RT-PCR با استفاده از سیستم RT-PCR یک مرحله­ای TITAN (ساخت شرکت Roche) و پرایمرهای XCE2- (5) و S1Uni2+(6) (جدول 1) انجام شد. پرایمرهای مذکور قطعاتی به­طول 1200 جفت بازی از ژن S1 که برای ویروس­های برونشیت عفونی مشترک است، تکثیر می­کنند.

واکنش RT-PCR با استفاده از بافر واکنش  RT-PCR(همراه با کلرید منیزیم)10 میکرولیتر، محلول DTT 5/2 میکرولیتر،dNTP  ها1 میکرولیتر، پرایمر جلو بر 2 میکرولیتر، پرایمر عقب بر 2 میکرولیتر، مخلوط آنزیمی1 میکرولیتر،RNA  الگو4 میکرولیتر، آب دوبار تقطیر استریل 5/27 میکرولیتر در حجم نهایی50 میکرولیتر انجام شد.

واکنش RT-PCR به­صورت انجام واکنش نسخه برداری معکوس RNA و سنتز cDNA در دمای 45 درجه سانتی­گراد به­مدت 45 دقیقه، واسرشت سازی اولیه ‍cDNA در دمای 94 درجه سانتی­گراد به­مدت 2 دقیقه، واسرشت سازی ‍cDNA در دمای 94 درجه سانتی­گراد به­مدت 30 ثانیه، همسرشت سازی در دمای 48 درجه سانتی­گراد به­مدت 2 دقیقه، گسترش در دمای 68 درجه سانتی­گراد به­مدت 2 دقیقه و گسترش نهایی در دمای 68 درجه سانتی­گراد به­مدت 10 دقیقه انجام شد. در این بررسی مرحله واسرشت سازی، همسرشت سازی و گسترش 35 سیکل تکرار شد (2).

در مرحله بعدی جهت شناسایی تیپ 91/4 برونشیت عفونی از محصول PCR مرحله اول استفاده شد و با تکنیک PCR Nested(PCR آشیانه­ای) قطعه اختصاصی تکثیر شد. بدین منظور از رقت یک دهم محصول RT-PCR در PCR آشیانه ای اختصاصی سروتیپ (793/B)4/91 استفاده شد. در واکنش PCR آشیانه­ای از پرایمر عمومی XCE3- و پرایمر اختصاصی B1+  برای تیپ 4/91(793/B) استفاده شد و قطعه­ای به طول 975 جفت بازی تکثیر شد (4) (جدول 1).

 

 

 

جدول1- اختصاصات پرایمرهای مورد استفاده در واکنش RT-PCR و PCR آشیانه­ای

 

نوع واکنش

نام پرایمر

توالی

موقعیت در ژن S1

ویژگی

منبع

RT-PCR

S1Uni2+

5’CCCAATTTGAAAACTGAACA3′

47-31

 

(6)

XCE2-

5’CCTCTATAAACACCCTTGCA3′

1193-1170

 

(4)

Nested-PCR

XCE3-

5’CAGATTGCTTACAACCACC3′

1111-1093

 

(4)

درمان برونشيت در طيور گوشتي

B1+

5’AAGTGCCTTTAGGCCTGG3′

110-93

4/91

(4)

 

 

واکنش PCR آشیانه­ای با استفاده از بافر (همراه با کلرید منیزیم) 5 میکرولیتر،dNTP ها 1 میکرولیتر، پرایمرها 4 میکرولیتر، آنزیم Taq پلیمراز 1 میکرولیتر، DNA الگو (محصول RT-PCR)4 میکرولیتر، آب دوبار تقطیر استریل 37 میکرولیتر در حجم نهایی50 میکرولیتر انجام شد.

واکنش PCR آشیانه­ای به­صورت واسرشت سازی اولیه ‍DNA در دمای 94 درجه سانتی­گراد به­مدت 3 دقیقه، واسرشت سازی ‍DNA در دمای 94 درجه سانتی­گراد به­مدت 1 دقیقه، همسرشت سازی در دمای 48 درجه سانتی­گراد به­مدت 2 دقیقه، گسترش در دمای 72 درجه سانتی­گراد به­مدت 90 ثانیه و گسترش نهایی در دمای 72 درجه سانتی­گراد به­مدت 10 دقیقه انجام شد. مرحله واسرشت سازی، همسرشت سازی و گسترش 35 سیکل تکرار شد.

در این بررسی از مارکر 100 جفت بازی ساخت شرکت فرمنتاز (Fermentase) استفاده شد و محصول تکثیر شدة نهایی به روش الکتروفورز در ژل آگارز 1% رنگ شده با اتیدیوم بروماید، با تابش اشعه UV مشاهده و مورد آنالیز قرار گرفت.

در این بررسی از واکسن 91/4 (Nobilis IB 4/91, Intervet International B.V.) به عنوان کنترل مثبت و آب مقطر استریل به عنوان کنترل منفی استفاده شد.

 

 

یافته­ها

   شناسایی ویروس برونشیت عفونی

واکنش RT-PCR و PCR آشیانه­ای

در واکنش RT-PCR با پرایمر عمومی برونشیت عفونی، قطعه­ای از ژن S1 به طول 1200 جفت بازی مورد تکثیر قرار گرفت. از 18 گله دارای علایم تنفسی مشکوک به برونشیت عفونی، نمونه­های متعلق به 11 گله مانند سویه­های رفرانس (کنترل مثبت) قطعه 1200 جفت بازی تکثیر کردند (نگاره 1). بنابراین از مجموع 18 گله مورد بررسی، 11 گله آلوده به ویروس برونشیت عفونی می­باشد.

در واکنش PCR آشیانه­ای، سویه رفرانس تیپ 91/4 قطعه­ای به طول 975 جفت بازی تولید کرد (نگاره 1). 5 جدایه چهارمحال و بختیاری درPCR آشیانه­ای، باند 975 جفت بازی تولید کردند. بنابراین 5 جدایه متعلق به تیپ 91/4 می­باشند.

 

 

 

نگاره 1- الکتروفورز سویه­های رفرانس

ستون 1: مارکر 100 جفت بازی

ستون2: نمونه مثبت ویروس برونشیت عفونی با محصول 1200 جفت بازی

ستون3: سویه رفرانس 91/4 با محصول  975 جفت بازی

بحث و نتیجه­گیری

    استفاده از  RT-PCR به همراه  PCRآشیانه­ای، یک ابزار تشخیصی برای ویروس برونشیت عفونی است که ضمن حساسیت بالاتر نسبت به جداسازی ویروس از طریق تخم مرغ جنین­دار و شناسایی سریع ویروس برونشیت عفونی (12)، سروتیپ­های مختلف این ویروس با روش PCR آشیانه­ای قابل تفریق می­باشد (10). از آنجایی­که تحت واحد S1 ویروس برونشیت عفونی دارای اپی­توپهای اختصاصی سروتیپ است (8) لذا در این بررسی مبنای شناسایی ویروس در روش RT-PCR و PCR آشیانه­ای، تکثیر قسمتی از ژن S1 ویروس برونشیت عفونی در نظر گرفته شد و با پرایمرهای اختصاصی تیپ، به شناسایی تیپ 91/4 پرداخته شد. در بررسی اخیر، از 11 سویه برونشیت عفونی در استان چهارمحال و بختیاری، 5 جدایه متعلق به تیپ 91/4 می­باشد. با توجه به اینکه گله­های مورد بررسی در طول دورة پرورش از واکسن 91/4 استفاده نکرده­اند لذا این مطالعه نشان می­دهد تیپ 91/4 در استان چهارمحال و بختیاری وجود دارد.

بررسی وضعیت بیماری برونشیت عفونی در ایران به گزارش آقاخان و همکاران در سال 1994 برمی­گردد. بررسی جدایه­های فیلدی توسط ایشان مؤید وجود سروتیپ ماساچوست به عنوان تنها سروتیپ ویروس برونشیت عفونی ایران بوده است (5). وجود بیماری برونشیت در بسیاری از گله­های ماکیان با مشکلات تنفسی علیرغم واکسیناسیون با سویه H120 این احتمال را تقویت کرد که ممکن است سروتیپ یا سروتیپ­های دیگر این ویروس، باعث رخدادهای جدید این بیماری شده باشد. اما حضور سویه 91/4 در ایران به گزارش وصفی مرندی و بزرگمهری فرد، در مورد یک واریانت جدید برونشیت عفونی در گله­های طیور (14) ایران در سال 1377 (1998) برمی­گردد که با بررسی­های مولکولی و تعیین توالی مشخص شد این واریانت متعلق به تیپ91/4 می­باشد (1). علاوه براین، گزارشاتی از حضور تیپ 91/4 در استان خوزستان (13)، فارس (11) و اصفهان (2) وجود دارد.

اگرچه چالش تجربی با این ویروس نشان دهنده بیماری­زایی تیپ 91/4 می­باشد (9) و این عامل ویروسی به عنوان یکی از عوامل تنفسی درگله­های طیور مطرح است (1) اما در مطالعه اخیر بیماری­زایی این ویروس در فارم­های مورد بررسی مورد مطالعه قرار نگرفته است که نیاز به مطالعات تکمیلی دارد. به هرحال با آشکار شدن حضور تیپ 91/4 در استان چهارمحال و بختیاری و گزارشات قبلی مبنی بر حضور یک واریانت برونشیت عفونی (14) و در مواردی اثبات حضور ویروس 91/4 در نقاط دیگر ایران (2، 13 و 11) به­نظر می­رسد با ورود این ویروس به ایران در نقاط مختلف کشور پراکنده شده است.

در اکثر بررسی­ها جداسازی سویه 91/4 در اواخر دوره پرورش جوجه گوشتی و در حدود  8-6 هفتگی گزارش شده است (3، 9 و 10) اما گزارشاتی نیز وجود دارد که نشان می­دهد امکان آلودگی با سویه 91/4 در گله­های گوشتی غیرایمن (غیر واکسینه)، در سنین پایین­تر وجود دارد (7). در بررسی اخیر، با شناسایی سویه 91/4 در جوجه­های گوشتی 21 و 25 روزه، احتمال آلودگی با این سویه در سن پایین تقویت می­گردد.

به طور کلی، این بررسی نشان داد شیوع ویروس برونشیت عفونی محصوصاً تیپ 91/4 برونشیت عفونی در فارم­های جوجه گوشتی استان چهارمحال و بختیاری به­عنوان یکی از استان­های واقع در نواحی غرب ایران بالاست. لذا در مرحله اول لازم است بیماری­زایی این ویروس در فارم­های پرورشی طیور بررسی شود و در مرحله بعد سیاست­های کنترلی مناسب جهت پیشگیری از این بیماری اتخاذ شود.

نسخه‌برداری و استفاده از مقاله‌های این نشریه تاع قانون دسترسی آزاد Creative Commons Attribution 4 می‌باشد.



 

 


بیماری
برونشیت

درمان برونشيت در طيور گوشتي

عامل بیماری: یک نوع ویروس ازخانواده کروناویریده می
باشد.

مکانیسم
ایجاد بیماری : برونشیت مزمن به دنبال نوعی التهاب در
مجاری هواییبزرگ (برونش‌ها) و کوچک و اپیتلیوم آلوئولهای ریوی
ایجاد می‌شود. التهاب مربوط بهبرونشیت بواسطه افزایش سلولهای
التهابی اطراف برونشیولها در پاسخ به محرکهای سمی ،میکروبی و
یا التهابی ایجاد می‌شود. در واقع افزایش فعالیت مواد اکسیدان
و کاهش فعالیتآنتی اکسیدان‌ها عامل بروز این التهاب است .

انتقال ویروس
برونشیت عفونی : ویروس بیماری برونشیت عفونی به سرعت در
میان طیور پخش می شود . پرندگان مستعد به بیماری اگر در اتافی
با پرندگان بیمار نگهداری شوند پس از 24 ساعت علائم بیماری را
از خود بروز میکنند . ویروس عامل این بیماری پس از 24 ساعت در
بورس ، کله ها ، ریه ها و نای پرندگان آلوده به این بیماری
وجود دارد . خیرا به اثبات رسیده است که ویروس واکسن IBV در
ارگانهای مختلف داخلی برای 163 روز یا بیشتر زنده باقی می ماند
. در خلال این دوره ، ویروس ممکن است بصورت دوره ایی در مدفوع
و ترشحات بینی پخش شود .

میزان شیوع و
مرگ و میر : این بیماری ، توانایی آلودگی تمامی پرندگان
موجود در یک گله را دارد . اما میزان تلفات ناشی از بیماری
متفاوت بوده و به عواملی چون :


1. حدت ویروس


2. سروتایپ
ویروس


3. سن گله درگیر


4. وضعیت ایمنی
گله درگی

5. کیفیت ایمنی
فعال و همچنین مادری در گله درگیر


6. بیماریهای
ثانویه باکتریایی


7. استرس های
محیطی


بستگي دارد .

اما میزان مرگ و
میر این بیماری از ملایم تا شدید متفاوت است . بر اساس تحقیقات
صورت پذیرفته ، برخی از سویه های تنفسی و NephroPathogenic چون
DE072 سبب بروز تلفاتی شدید در گله های تحت پرورش میشوند . این
در حالیست که سویه هایی چون T استرالیایی سبب بروز تلفاتی اندک
میشوند .

جنسیت جوجه ها ،
وضعیت گله مادر و تغذیه ، از فاکتورهایی میباشند که در شدت
بروز ضایعات کلیوی ، موثر میباشند . میزان تلفات این بیماری در
جوجه هایی با سن کمتر از 6 هفته بالا میباشد ( 25 درصد یا
بیشتر ) در حالیکه در جوجه هایی با سن بیش از 6 هفته ، بطور
معمول اندک است .

مقاومت ویروس
دربرابر عوامل شیمیایی و فیزیکی :

1. درحرارت 56
درجه سانتیگراد پس از 15دقیقه غیرفعال می شود.

2. درمحیط های
اسیدی و قلیایی غیر فعال می شود.

3. اکثرضدعفونی
کننده های موجود در داروخانه ویروس را ازبین می برند.

میزبانها:
بطورطبیعی بیماری درکلیه ماکیان (مرغ وخروس ) دیده می شود.

علائم
بیماری: علائم بیماری به دو فرم بیماری دیده می شود :

1- فرم تنفسی          
2- فرم کلیوی

در اکثر مواقع
هردو فرم بیماری همزمان دریک گله دیده می شود.

علائم فرم
تنفسی : شایعترین و رایج ترین فرم از بیماری درتمام سنین
می باشد که دارای علائمی بشرح ذیل است:
رالهای تنفسی،نفس نفس زدن، عطسه ، سرفه، ریزش ترشحات از بینی و
اشک، تورم صورت، تنفس بادهان باز، کزکردگی وکاهش مصرف دان،
کاهش تولیدتخم مرغ تا50درصدولبه گذاری درمرغان تخمگذار. علائم
تنفسی خفیف از قبیل عطسه ،تنگی نفس و خروج اب از چشمها
وسوراخهای بینی همراه این بیماری می باشد0 . معمولا” بیماری
دراواخرتابستان و اوایل پائیز شایع می گردد. انتشاربیماری
بسیارسریع است دوره نهفته بیماری 3-1 روزاست .
درصورتی که بیماری باسایرعوامل عفونت زا همراه نباشد ممکن است
درجوجه ها تا 30 درصد تلفات ایجاد کند،بدیهی است درکمپلکس با
سایر بیماریها تلفات بالاتر می رود .

علائم در فرم
کلیوی : معمولا” درجوجه های جوان باسن 6-3 هفته بروز می
کند و دراین حالت جوجه ها علائمی ازقبیل کزکـــردگی ، بی
اشتهائی ، اسهال سفید و اوراتی و گاهی علائم تنفسی دیده می
شود. تلفات حدودا” به 30 درصد بالغ می گردد.

برونشیت
عفونی و تاثیر آن بر تولید و کیفیت تخم مرغ :

شیوع دردسته
جوجه های زیریک سال ممکن است تاثیرات مخربی برتولیدات آینده
داشته باشد. دستگاه تولیدمثل کلیه ها ممکن است دچار صدمات
دائمی شوند. درمرغان بالغ بسته به رده ویروس شیوع تاثیرات
گوناگونی بر تولید تخم مرغ خواهد داشت. در پرندگان مبتلا با
تعداد آنتی بادی های بسیار تنها تظاهر بیماری تاثیرات خفیف تا
شدید بر پوسته تخم مرغ و محتویات درون آن بدون تاثیر برروند
کلی تولید تخم مرغ خواهد بود. درصورت ابتلا به برونشیت انتظار
کاهش کیفیت پوسته تخم مرغ و محتویات درونی ‌آن می رود. تاثیر
منفی برکیفیت تخم مرغ ممکن است برای هفته ها وماه ها پس از
بهبودی ادامه یابد.
ویروس بسیاری از بافتهای بدن رادچار عفونت می کند.هربخش از
دستگاه تولید مثل ممکن است تحت تاثیر قراربگیرد. دراثر ابتلای
مستقیم رحم به ویروس کاهش کیفیت پوسته تخم مرغ را خواهیم داشت.
این مسئله تحت عنوا ن کاهش ضخامت پوسته و بدشکلی تخم مرغ ها
ناشی از زوال وبد شکلی سلول های غده ای پوسته می باشد ..
جوجه های زیر یکسال مبتلا به برونشیت ممکن است از آسیب های
دائمی لوله های رحمی (یااویدوکت)رنج ببرند که خود منجر به بد
شکلی تخم مرغ های تولیدشده می شود. تنگی لوله های رحمی پارگی
رحم ولایه های داخلی ونیزکیست های لوله های رحمی یااویدوکت
راست از جمله علائم ابتلای زود هنگام به ویروس می باشد .


انتقال
بیماری :

ویروس از طریق
استنشاق یا ورم ملتحمه چشم وارد بدن می شود. برونشیت عفونی به
عنوان یک بیماری تنفسی و به شدت مسری شناخته شده است. رایج
ترین روش انتشارویروس ،انتقال مستقیم آن ازطریق هواوازطریق
دستگاه تنفسی پرنده های یک گله به یکدیگروازیک گله به گله ای
دیگرمی باشد.

پیشگیری و
کنترل بیماری:
بر دو اصل واکسیناسیون و اقدامات بهداشتی و قرنطینه ای استوار
می باشد .
واکسیناسیون :
برنامه واکسیناسیون پیشنهادی جهت پیشگیری در جوجه های گوشتی :


سن

درمرغان تخمگذار
و مادرعلاوه بر واکسیناسیون فوق از واکسنهای تزریقی نیز بایستی
با هماهنگی دامپزشک فارم استفاده شود.

اقدامات
بهداشتی و قرنطینه ای زیربایستی جهت پیشگیری ازبیماری انجام
شود:

1- درطی دوره
پرورش از ورود افراد متفرقه به محوطه بویژه سالنها جدا”
جلوگیری نمائید
2- افرادی که ضرورتا” به واحد رفت وآمد می نمایند درهنگام ورود
ازکفش و لباس ویژه مرغداری استفاده نمایند.
3- درانتهای دورره پرورش ، پس از تخلیه سالنها، کلیه موارد
بهداشتی شامل پاکسازی کامل سالن، محوطه، شستشو و ضدعفونی سالن
و محوطه و تجهیزات مرغداری را رعایت فرمایید.
4- درکلیه ورودیها حوضچه مخصوص جهت کفش ها وخودروها تعبیه
وبطورکامل ازآن استفاده شود.
5- جهت جلوگیری ازپخش گردوغباروپرز ازسیستم داکت وحوضچه
ضدعفونی زیرآن درپشت تهویه استفاده نمائید.
6- ورود به مرغداری وسالنهارابه یک محل محدودنمائید
7- حتی المقدور درمرغداریهای گوشتی نهاده ها ازمنبع مطمئن تهیه
وبری یک دوره ذخیره گردد.
8- درتمام دوره پرورش رطوبت توصیه شده توسط تولیدکننده جوجه
یکروزه راتامین نمائید.بدیهی است رطوبت درطول فصول تابستان
وپائیز ازاهمیت بیشتری برخورداراست.
9- تهویه منسب توام بادمای مطلوب تهیه گرددکاهش اکسیژن، افزایش
گازآمونیاک وخشکی هواونوسانات دما بعنوان استرس محسوب شده
وزمینه سازبروزکلیه بیماریهای تنفسی بویژه برنشیت می شود.
10- باتوجه به اینکه بروز بیماری تنفسی ازقبیل آنفلوانزا، کلی
باسیلوز و… تشدیدکننده برونشیت هستندلذاجهت مبارزه بابرونشیت
، مبارزه باسایربیماریهای تنفسی ضروری است .
11- از خرید جوجه های ام ج مثبت خودداری نمایید وازواکسیناسیون
گله های ام ج مثبت به شیوه اسپری خودداری نمائید.
12- واکسیناسیون گله مطابق بادستورالعمل های صادره ازاداره کل
دامپزشکی صورت پذیردولذاازبرنامه های سلیقه ای جدا” خودداری
نمائید.
13- درصورت بروز هرگونه علائم تنفسی وتلفات غیرعادی علاوه
برمشورت بادامپزشک فارم شبکه دامپزشکی محل راجهت بررسی بیماری
مطلع فرمائید.
 

 
.Copyright © 2013 
 MAD
TIUOR
 Company 
All Rights Reserved

بیماری برونشیت عفونی طيور نوعی بیماری ویروسی بسیار مسری تنفسی طیور است که مشخصه آن تراكئيت  ، سرفه و عطسه میباشد . این بیماری سبب تلفات و زیانهای اقتصادی بالابا علت  تلفات سنگين  ، وزن گیری پائین و کاهش بازده غذایی ، بروز عفونتهای مختلف پیچیده خواهند شد . همچنین علت اصلی افت تولید تخم مرغ و همچنین کیفیت آن میباشد . انتقال سريع این بیماری و وقوع چندگانه سروتیپهای ویروس این بیماری حالت بسیار پیچیده ایی را ایجاد نموده است.

 میزان مرگ و میر در جوجه های گوشتی ظرف مدت دو هفته به حداکثر مقدار ممکن می رسد و  ازسن ۱۵ الي ۴۵ روزگي زندگی آنها رخ میدهد . مرگ و میر نیز بطور معمول بر اثر عفونتهای باکتریایی ثانویه روی میدهد . عفونتهای باکتریایی نیز بدلیل صدمه خوردن به مجاری تنفسی بر اثر ویروس بیماری برونشیت میباشد .وقوع بیماری با سن نسبت عکس دارد .  برخی از س.یه های این ویروس ، بشدت خاصیت نفروپاتوژنيك داشته و توانایی گرفتن تلفات تا ۳۰ درصدی را از گله های جوجه های جوان دارند . ویروس این بیماری در داخل اويدوكت نیز تکثیر می یابد . بیماری برونشیت عفونی در پرندگان تخمگذار که سن بالا دارند میتوانند منجر به کاهش ۱۰ تا ۵۰ درصدی و یا بیشتر در تولید میشود . همچنین با بروز این بیماری ، تولید تخم مرغهای بدشکل نیز افزایش خواهند یافت . بطور معمول ، میزان تولید ، پس از بروز این بیماری به حالت عادی باز نخواهد گشت . برخی از مواقع ، بروز این بیماری در پرندگان جوان ، سبب رشد ناقص و ناکافی اويدوكت خواهد شد . اپيدميولوژي بيماري بیماری برونشیت عفونی در سراسر دنیا گسترش یافته است . در ایالات متحده ، علاوه بر سویه های بومی ( نوع Massachusetts  ) چندین سروتایپ دیگر نیز شناخته شده است . در ابتدای سال ۱۹۵۰ میلادی ، زنجیره های نوع Mass در اروپا مشاهده شدند . در واقع ، بسیاری از انواع سروتیپهایی که در آمریکای شمالی شناسایی شده بودند ، پس از مدتی در آفریقا نیز مشاهده شدند . این بیماری در کشورهای آسیایی چون هند ، ژاپن ، کره و چین و همچنین استرالیا و اروپا شیوع یافته است . غالبا شیوع IB حتی در گله های واکسینه شده نیز روی میدهد . انواع ویروسهای جدا شده از این دسته شیوع ، غالبا ( نه همیشه ) از سروتایپی متمایز از واکسن میباشند .

 طبقه بندی

ویروس بیماری برونشیت عفونی از خانواده Coronaviridae میباشد . این ویروس شامل دو جنس میباشد : ۱) Coronavirus ۲) Torovirus در واقع ، IBV عضو گروه سوم جنس Coronavirus میباشد . دو گروه دیگر شامل انواع Coronavirus موجود در پستانداران میباشد که بطور گسترده ایی از لحاظ سازمان یافتگی ژنوم و تناوب ژنی با ویروس برونشیت عفونی متفاوت است . طبق گزارشات ارائه شده ، بیان نحوه مصونیت انسان در برابر این بیماری بسیار مشکل است . اخیرا نشان داده شده است که برخی از انواع Coronavirus های جدا شده از بوقلمونها شباهت بسیار زیادی به IBV دارند . این ویروسها ، نیز در گروه سوم Coronavirus ها طبقه بندی میشوند . تاکنون بطور قطعی انواعی از Torovirus ها بعنوان عامل بیماریزا در پرندگان شناسایی نشده است . 

 مورفولوژی ویروس بیماری برونشیت عفونی از لحاظ شکلی بسیار پلئومورفیک  است .   این ویروس ۱۲۰ نانومتر قطر و ۲۰ نانومتر طول دارد . در سطح این ویروس نیز زائده های گرز مانندی وجود دارد . بایستی توجه داشت که این زائده ها همانند گروه ParamyxoVirus نمیباشد . در این گروه ، زائده های از یکدیگر فاصله دارند اما در گروه ParamyxoVirus ، این زائده ها با فاصله بسیار کمی از یکدیگر قرار گرفته اند . ساختمان رینوکلئوپروتئینها ( RNP ) در اینحالت بصورت قطعه قطعه شده دیده میشود . توجه داشته باشید که این ذرات را با آلودگیها اشتباه نگیرید . در اکثر نمونه ها ، قطر RNP بصورت استاندارد ، یک تا دو میلیمتر در نظر گرفته میشود . اما در برخی از مشاهدات ، بصورت اتفاقی ذراتی با ساختمان حلقوی و قطر ۱۰ تا ۱۵ نانومتری گزارش شده است . اگرچه تاکنون نوع ToroVirus در این بیماری مشاهده نشده است ، گزارشهای ثبت شده ، حاکی از شباهت بسیار بالای ToroVirus و CoronaVirus در میکروسکوپ الکترونی میباشد . گونه های مختلف ویروس برونشیت عفونی ، در فشردگی دانه های ساکاروز با یکدیگر متفاوت میباشند . از سوی دیگر ، سانتریفیوژ با قدرت بیشتر از ۱۰۰.۰۰۰ دور سبب از بین رفتن گرزها و قسمتهای مختلف این ویروس میشود . با تحقیقات صورت گرفته ، زیرمجموعه های S۱ بعنوان عوامل فرم گرفتن پروتئینهای قسمتهای گرز مانند شناخته شده اند . انکوباسیون ویروس در دمای ۳۷ درجه سانتی گراد میتواند نجر به از بین رفتن زیرمجموعه های S۱ شود . ترکیب شیمیایی ویروس بیماری برونشیت عفونی ، شامل سه ساختمان پروتئینی مهم میباشد : ۱) زائده های میخ مانند ( S ) . ۲) غشاء ( M ) . ۳) گلیکوپروتئینها و نوکلئوپروتئینها ( N ) . بعلاوه ، پروتئین چهارم ( CE ) بعنوان عامل تشکیل دهنده پوشش ویروس شناخته شده است . پروتئین S ، دو تا سه کپی را ار هریک از دو گلیکوپپتیدها میگیرد ( S۱ و S۲ )  . آزمایشاتی چون HI  و  VN  بر پایه پروتئینهای S۱ میباشند . تنها در حدود ۱۰ درصد از پروتئینهای M ، بدون حفاظ و در سطوح خارجی ویروس قرار دارند . پروتئین N نیز در اطراف بخش Single Stamdard قرار دارد .

درمان برونشيت در طيور گوشتي

 ژنوم RNA ویروس  نهایتا از ۲۷۶۰۰ نوکلئوتید تشکیل شده است که هرکدام از آنها کلون شده و متناوب میباشند . پاکسازی و تصویه ویروس در سلولهای پلی پپتید میزبان صورت می گیرد . تشخیص پروتئین S۲ از طریق روش Coomassic Blue Staining مشکل بوده و برخی از پروتئینهای N نیز تجزیه شده و از بین میروند .

تکثیر ویروس ویروس بیماری برونشیت عفونی در سیتوپلاسم تکثیر میشود . در یک مکانیسم نسخه برداری غیر ادامه دار ، شش RNA پیام رسان ترکیبی دوباره را پدید می آورند . ترکیب ویروس نیز ، با انجام عملیاتی در غشاء آندوپلاسمیک رتیکولوم روی میدهد و نه در سطوح سلول . پروتئینهای S بر خلاف پروتئینهای M ، در میان رتیکولوم  به سطوح سلول مهاجرت می کنند . ویروسهای جدید ظرف مدت سه تا چهار ساعت پس از آلودگی شروع به پیدایش می کنند . ظرف مدت ۱۲ ساعت ، در ۳۷ درجه سانتیگراد تعداد زیادی از این ویروسها پدید می آیند . 

 مقاومت به عوامل شیمیایی و فیزیکی بیشتر گونه های IBV پس از ۱۵ دقیقه در ۵۶ درجه سانتیگراد و یا پس از ۹۰ دقیقه در ۴۵ درجه سانتیگراد غیرفعال میشوند . بقای این ویروس در هوای آزاد ، در بهار تا بالای ۱۲ روز و در زمستان تا ۵۶ روز گزارش شده است . بطور معمول ، IBV به اتر حساس است . اما برخی از گونه های این ویروس در اتر ۲۰ درصد زنده خواهند ماند ( ۴ درجه سانتی گراد ، هجده ساعت ) . از سوی دیگر ، ویروس این بیماری با کلروفرم ۵۰ درصد NV دمای اطاق در عرض ۱۰ دقیقه  نابود میشود .

كشت ويروس ويروس در عرض يك ساعت در مجاورت تريپسين 1% گلبولهاي قرمز مرغ را جمع مي كند . در جنين تخم مرغ 10-9 روزه و كشت بافت ريه و كليه جنين رشد مي كند و كليه جنين حساسترين كشت است . در پاساژ اول در روي جنين آثار چروكيدگي كيسه جنين و كلفت شده پرده آمينيون مجاور حنين و كوچك شدن جنين ديده مي شود و وضعيت داخلي جنين به هم خورده است و بالها روي سر قرار مي گيرند و مثل پاها روي سر فشار ميآورند . ويروس بايد 10 پاساژ داشته باشد تا جنين را بكشد . بيماريزايي بيماري مخصوص ماكيان است و سويه هاي مختلف بافتهاي مختلف اپي تليال ناي (از بين بردن مژه ها) ، اپي تليال مجراي تخم در دستگاه توليد مثل و حتي كليه را درگير مي كنند . در زمستان بيماري فراوانتر و با تلفات بيشتر است. انتقال ويروس IB مهمترين راه باد وراه Air born است ولي بطور مكانيكي با افراد و وسايل . . . نيز صورت ميگيرد . حاملين نقش چنداني ندارند و مبتلايان در عرض 6-4 هفته پاك مي شوند . ولي مرغهاي كمي آلوده باقي مانده و در دورة تخمگذاري بعلت تخمگذاري شديد هورموني در صورت ايمني پائين گله سبب انتشار بيماري مي شوند . شفا يافتگان ايمني قوي دارند . ايمني ايمني موضعي دستگاه تنفسي نقش اصلي را دارند . انترفرون و ايمني سلولي دخالتي ندارند ولي ايمني هومورال در ايمني پاسيو نقش دارد كه تنها باعث كاهش شدت بيماري مي شود و از بيماري جلوگيري نميكند . اگر ايمني پاسيو مادري توسط سوش بيماريزا باسوش واكسن يكي باشد از نتيجة واكسن مي كاهد . علائم بيماري دوره كمون كوتاه و 96-36 ساعت است و ارزش تشخيصي دارد براي اينكه در عرض 3-2 روز تمام گله را بيمار مي كند در حاليكه در بيماريهاي ديگر چنين نمي شود . جوجه زير 6 هفتگي : ترشح چشم و بيني ، كم مصرف شدن آب و دان ، دور هم جمع شدن ، سرفه ، عطسه ، نفس نفس زدن ، تنفس با دهان باز ، سوت كشيدن و مرگ در اثر خفگي . گلة بالغ : كاهش شديد تخم مرغ تا 50% كه 5-4 هفته ادامه دارد و بعد از اين مدت بتدريج بالا ميرود ولي بمقدار اوليه نميرسد . پوستة تخم مرغ اگر قهوه اي بود بي رنگدانه و سفيد مي شود ، نازك و ترك خورده است و گاهي تخم مرغ پوسته سفت را ندارد و لمبه اندازي صورت ميگيرد . تخم مرغها شكل هاي غير طبيعي دارند . دانه هاي گچي روي پوسته است كه پوسته را زبر مي كند . سفيده آبكي است و بعلت غشاي نازك زرده به سهولت زرده با سفيده قاطي مي شود (مثل يك تخم مرغ فاسد) . فرم كليوي بيماري اين فرم بيشتر در 26-6 هفتگي ديده مي شود ولي در صورت عدم تماس جوجه يا مرغ با ويروس در هر سني ديده مي شود . در مرحله اول علائم زودگذر تنفسي ديده مي شود . در مرحلة دوم ويروس به كليه حمله كرده ← دفع سديم و پتاسيم← خون غليظ و پوست بدن و تاج و ريش خشك و تيره مي شوند . اسهال شديد سفيد رنگ (اسهال گچي) كه به مجرد اينكه به زمين برسد مثل گچ سفيد و سخت ميشود . اين اسهال منشأ كليوي دارد در صورتي كه اسهال گچي دستگاه گوارش آبكي است . 21-6 روز بعد از بروز بيماري تلفات بالا ميرود و بعد از 24 روز تلفات پائين ميآيد . ميزان تلفات در شرايط خوب بهداشتي 10-5% و در شرايط نامساعد بهداشتي 50% است . نژادهاي سبك به اين فرم بيماري حساستر از نژادهاي سنگين هستند . خروسها به اين فرم حساستر از مرغها هستند . كالبدگشايي فرم تنفسي : ترشحات چرك پنيري در چشم و دستگاه تنفس بخصوص در محل دو شاخه شدن ناي (علت خفگي) ، پرخوني ناي و ريه كدورت كيسه هاي هوايي و پنوموني ريه . فرم كاهش توليد تخم مرغ : احشاي داخلي و درده پرخون ، زرده له شده ، طول و وزن اويروكت ↓ (كه در 21روز بعد به حالت عادي برميگردد) اگر گله در زير 2هفتگي مبتلا شود ويروس به اپي تليال اويروكت جمله و جراحات كيستيك ايجاد مي كند كه در هنگام تخمگذاري بسته به محل كيست تخم مرغ ناقص ساخته مي شود عليرغم آنكه مرغ ظاهر خوب يك تخمگذار خوب را دارد . فرم كليوي : جراحات لاشه بعد از 5روز حمله ويروس ديده مي شود . تورم شديد كليه ، رسوبات فراوان در كليه و مجاري ادراري كه باعث ترشحات اسهالي مي شود . رسوبات اورات در كبد ، قلب و احشاء باعث ايجاد نقرس احشايي مي شود . تشخيص برونشيت عفوني دوره كمون خيلي كوتاه ، فرم تنفس (دهان باز و نفس نفس زدن) و آزمايشگاه . ميكروسكوپ الكتروني ، پادتن هاي درخشان ، پادتن هاي خنثي كننده (در ابتداي بيماري و دو هفته بار با دو بار آزمايش) ، ژل ديفوزيون ، HI ، الايزا ، ديدن رشد در جنين تخم مرغ . (با آزمايش الايزا آنتي ژنهاي عمومي IB و اختصاصي سروتيپ ها جواب ميدهند لذا نمي توان از آن براي تشخيص سروتيپ و واريانت ويروس استفاده كرد و براي اينكار بايد از HI و VN بهره گرفت) . هيستوپاتولوژي نفوذ لنفوسيت ها و مونوسيت ها در زير مخاط ناي ، از دست رفتن مژه هاي سلولهاي پوششي اپي تليال ناي . تشخيص تفريقي IB فرم تنفسي : لارنگوتراكئيت ، آسپرژيلوزيس ، پاستورلوز ، لارنگو بيشتر سنين بالا را مبتلا مي كند . فرم كاهش توليد : ND و EDS در نيوكاسل علائم عصبي نيز داريم . واكسن هاي IB واكسن كشته : از غيرفعال شدن ويروس حاد با موادي مثل فرمالين 2/0% و بتاپروپيولاكتون 1% بدست ميآيد . در 12 هفتگي (4-3 هفته قبل از تخمگذاري) مصرف مي شود . حتماً تزريقي است و با واكسن هاي كشته ND + IB (دوتايي) و ND + IB + EDS (سه تايي) همراه مي شود .واكسن زنده : از سوش ماساچوست استفاده مي شود (با 120بار پاساژ) و (با 52بار پاساژ) . هر چه پاساژ زيادتر باشد بيماريزايي و ايمني زايي كمتر مي شود . لذا در جوجه ها مصرف مي شود . واكسيناسيون  واكسن در 5-1 روزگي و اكثراً در 1 روزگي مصرف مي شود . واكسيناسيون بصورت اسپري و در داخل كارتن حمل جوجه ها انجام مي شود . ميزان مصرفي واکسن در 200سي سي آب براي هر هزار دوز واكسن است كه از سمپاش هايی  كه قطرات درشتي از آب را روي سر جوجه اسپري مي كنند استفاده مي شود . براي تقويت ايمني مرحلة اول  واكسن دوم در ۱۴ روزگي بصورت قطره يا آب آشاميدني مصرف مي شود . cr88 یا 91/44-3 هفته به تخمگذاري واكسن از طريق آب آشاميدني مصرف مي شود كه براي هر يك دورة تخمگذاري كافي است .  استفاده از واکسن اول بر استفاده از (ND + IB) ارجعيت دارد .درمان IB بعلت تخريب سلولهاي اپي تليال تنفسي و هجوم ميكروبهاي ديگر بخصوص مايكوپلاسما آنتي بيوتيك هاي وسيع الطيف لازم است . براي بالا بردن مقاومت بدن افزايش 3-2 درجة سانتيگراد درجه حرارت براي 3-2 هفته بهتر است . تشويق به غذا ،  ، عدم تراكم ، و عدم گرد و غبار در بهبود گله نقش دارد . اگر بيماري از فرم كليوي باشد  كاهش یروتیین حیوانی جيره و نيز تجويز الكتروليت ها .

درمان برونشيت در طيور گوشتي

درمان برونشيت در طيور گوشتي

10

پیشنهاد شده برای شما :
0 sarah فواید،علائم،خواص آوریل 1, 2018
برچسب ها :

پاسخی بگذارید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *